International Research Journal of Biological Sciences ___________________________________ ISSN 2278-3202Vol. 2(12), 79-84, December (2013) Int. Res. J. Biological Sci. International Science Congress Association        
79
 
Simultaneous detection of Photobacteriumdamselae, Vibrio alginolyticus, Vibrio harveyi and Vibrio parahaemolyticus using multiplex PCR amplification methodRansangan J. and Lal M.M.T. Microbiology and Fish Disease Laboratory, Borneo Marine Research Institute, Universiti Malaysia Sabah, Jalan UMS, 88400 Kota Kinabalu, Sabah, MALAYSIAAvailable online at: 
www.isca.in, www.isca.me
Received 11th August 2013, revised 24th September 2013, accepted 22nd October 2013Abstract  The aim of this study was to develop a multiplex PCR amplification method that simultaneously detects the presence of four bacterial pathogens (Photobacteriumdamselae, V. alginolyticus, V. harveyi and V. parahaemolyticus), which are often synergistically caused disease to culture fish throughout the tropical waters, and occasionally cause food poisoning and wound infection to human. Specific multiplex PCR primers targeting conserve regions of virulence genes of the pathogens were designed and tested against different concentrations of MgCl and annealing temperatures. In addition to specificity against different bacterial species, the multiplex PCR was also tested against tissue and environmental samples known to harbor the pathogens. The result showed that the multiplex PCR was highly specific to the target pathogens. The optimumMgCl2 concentration and annealing temperature for successful multiplex PCR amplification of the pathogens were at5.0 mM and 56 °C, respectively. The detection limit of the multiplex PCR was at 10 pg of DNA template. Although the concentration of the pathogens in the environment is often lower, enrichment with tryptic soy broth supplemented with 2% NaCl (w/v) has shown to enhance the growth of the bacterial pathogens and hence improved detection. The rapidity, simplicity and cost-effectiveness of the multiplex PCR amplification method described in this paper provide a useful bio-security tool for the determination of the pathogens in aquaculture farms and seafood processing industries throughout the tropical countries. Keywords:Multiplex PCR, fish bacterial pathogens, simultaneous detection. Introduction Bacterial diseases are one of major problems causing fish mortality and economic loss in aquaculture. Studies showed that Photobacteriumdamselae, Vibrio alginolyticus, V. harveyi and V. parahaemolyticus are highly virulent and may responsible for many disease outbreaks occurring in marine aquaculture farms throughout tropical waters1-4. These bacteria have also been reported to affect human health especially the P. damselaeV. alginolyticus6 and V. parahaemolyticus. Nevertheless, the current detection methodsfor these pathogens are either time consuming, expensive or only allow detection of single pathogen at a time. Co-existence of these bacteria in a given sample may cause detection difficulty. Moreover, the ability of one bacterium to grow faster may also cause the detection other bacteria difficult. For example, V. alginolyticus has been reported to easily out number other Vibrio species in environmental samples. Differentiation of these bacteria using phenotypic characterization and 16S rRNA sequencing is also difficult because of high genome homology amongVibriospecies10. Although Vibrio species can be accurately identified using other markers such as the atpAgene11, it is a time consuming and expensive process. Considering the damages that these bacteria can bring about to fish and human, rapid, simple, simultaneous and low cost detection method is necessary. Multiplex PCR amplification method has been widely applied in the detection of fish bacterial pathogens12 and food-borne pathogens13-15. However, no multiplex PCR method has been so far reported that simultaneously determine the presence of the above-mentioned bacterial pathogens. The ability to determine bacterial pathogens using multiplex PCR method was reported dependent to the target genes. Fortunately, both housekeeping and virulent genes can equally serve as good targets for multiplex PCR amplification. Fadaeifard et al.16 and Mata et al. 12have used ribosomal genes as the target for multiplex PCR amplification of streptococcal infections. However, Bauer and Rørvik15 have used virulent genes successfully in the multiplex PCR amplification for food-borne bacteria. According to Panickeret al.14, different genes could be used as a target for PCR amplification of all subtypes of V. parahaemolyticustlh, tdh, trh and ORF8), V. vulnificus vvh and viuB) and V. cholera ompU, toxR, tcpI and hlyA). However, Bauer and Rørvik15 also showed that single gene (ToxR) can be used as the target PCR amplification of similar bacterial species. Nevertheless, we strongly believe that virulent genes could serve a better target for multiplex PCR amplification because of their divergence and 
International Research Journal of Biological Sciences ________________________________________________ ISSN 2278-3202   Vol. 2(12), 79-84, December (2013)  Int. Res. J. Biological Sci.     International Science Congress Association 
80
highly conserved among Vibrionaceae17. In this paper, we described a multiplex PCR amplification method which can detect the presence of the four bacterial pathogens simultaneously. Material and Methods  Bacterial specimens: The four bacterial specimensused in this studyincluded V. alginolyticus (ATCC 17749), V. harveyi (ATCC 35084), V. parahaemolyticus (ATCC 17802) and Ph.damselaeSA1. The three bacterial specimens were acquired from American Type Culture Collection (ATCC), while Ph. damselae SA1 was isolated from diseased fish during fish mortality event in Sabah (Malaysia) in 2011. All the bacterial specimens were authenticated using 16S rRNA gene sequencing (unpublished data). The bacteria were maintained in tryptic soy broth (Merck) supplemented with 2% sodium chloride (Merck) at 28C. Bacterial genomic DNA was extracted from overnight bacterial culture using the DTAB-CTA Bextraction method described by Philips and Simon18. Primer design and synthesis:Selected virulence genes (AF17088617, X6263519, GQ14907020 and AB30086921) used inprimer design are listed in table-1. DNA sequences ofthose selected genes were downloaded from GenBank database at http://www.ncbi.nih.gov. Subsequently, the DNA sequences werealigned using the MegAlign, DNAstarLasergene Version 7. The primers consisted of 17 to 23 base pairs with the percentage of GC content ranged from 40 – 65 %.The forward and reverse primers were carefully selected in order to generate perfect lengthof non-overlapping PCR products.The PCR primers were synthesized at AIT Biotech Ptd. Ltd (Singapore). Finally, the PCR primers (in lyophilized form) were diluted in TE Buffer (pH 8.0) to make the final concentration to 10 µM and stored at-20 °C until used. Specificity of PCR primers:Each pair of PCR primers was tested against DNA from target and non-target bacteria. Sterile double distilled water was used as negative control. The PCR mixtures consisted of 1 X PCR buffer (Promega), 1.7 mM MgCl2 (Promega), 200 µM dNTPs (Promega), 0.4 µM of each forward and reverse primers, 1 U Taq DNA polymerase (Promega) and 50 ng DNA in 25 µl reaction. The PCR was carried out under the following conditions; 3 min in 95°C, 30 cycles of each 95°C (30 sec), 56°C (30 sec) and 72°C (30 sec) and final extension for 5 min at 72°C in a thermal cycler(Applied Biosystems). The PCR products were separated on 1.5% agarose gel electrophoresis stained withethidium bromide and visualized using a Gel Documentation System (Alpha Innotech). Optimization of primersfor multiplex PCR amplification: The PCR primers was optimized against different MgClconcentrations (1.8, 2.0, 3.0, 4.0, 5.0 and 6.0 mM) and annealing temperatures (56, 58, 60, 62 and 64 °C). The DNA template used for the optimization test was a combination of DNA from the four target bacteria. 2µl (25 ng/µl) of DNA from each target bacteriawas used in every25 µl reaction. PCR amplification was carried out according to the conditions described above except for MgCl and the annealing temperatures. Specificity of the multiplex PCR amplification: The specificity of the multiplex PCRamplification was evaluated against DNA from 24 bacterial species (Aeromonascaviae ATCC 15468, A. hydrophila ATCC 7965, A. salmonicidasubsp. Salmonicida ATCC 33658, Edwardsiellatarda ATCC 15947,Escherichia coli ATCC 25922, E. coli JM109, Micrococcuslysodeikticus ATCC 4698, Proteus mirabilis ATCC 29245, Pseudomonasaeruginosa ATCC 27853, Ps. Fluorescens ATCC 13525, V. anguillarum ATCC 19264, YersiniaruckeriATCC 29473, Ph. Damselae PDTG2, V. harveyi VHJR7, V. harveyi VHJR4 and V. parahaemolyticus VPHG1.The multiplex PCR was also evaluated against total bacterial DNA from environmental samples previously enriched with tryptic soy broth (Merck) at 28C for overnight incubation.     Table-1 List of primers used in the multiplex PCR amplification of the bacterial pathogens Target bacteria Primer name Primer sequence (5’-3’) Expected size (bp) Gene Reference (Accession number) 
Ph. damselae SA1 MpJRPdF MpJRPdR CGGTTATCAAATGATCGCAAC CTTGCACCCCTTTAACCG 355 AF170886 
V. alginolyticusATCC17749MpJRValF MpJRValR CTCTCCCAATTCAGCCCTCTA GACTCTTCACAACAGAACTC 773 X62635 
V. harveyi ATCC 35084MpJRVhF MpJRVhR ACGCTTGATGGCTACTGGTGGAG CTTCGCACCTGCATCGG 606 GQ149070 
V. parahaemolyticus ATCC 17802MpJRVpF MpJRVpR CCGTTCCAAAACGAGGCTATC CGAGTGGTTGCTGTCATGA 521 AB300869 
International Research Journal of Biological Sciences ________________________________________________ ISSN 2278-3202   Vol. 2(12), 79-84, December (2013)  Int. Res. J. Biological Sci.     International Science Congress Association 
81
Detection limit of the multiplex PCR amplification:The detection limit of the multiplex PCR amplification was tested against different concentrations of genomic DNA (10, 1, 0.1, 0.01 and 0.001ng) at the conditions described above. Results and Discussion The primers specifically amplified the genes in the target bacteria (figure-1) with non-overlapping PCR products. The optimum concentration of MgCl2 and annealing temperatures required for the multiplex PCR amplification (figure-2) of the four bacteria simultaneously was at 5.0 mM and 56 – 58°C, respectively. The multiplex PCR amplification showed high specificity to target bacteria. It did not amplify the non-target bacteria. Interestingly, it has excellently amplified total DNA from environmental samples previously enriched with the target bacterial cells (figure-3). The test against DNA concentration showed that the multiplex PCR amplification method efficiently amplified as low as 0.01 ng or 10 pg of DNA from target bacteria (figure-4). 
Figure-1 PCR amplification was specific to target bacterial pathogens. Lane 1 to 5 = Ph. damselae, V. alginolyticus, V. harveyi, V. parahaemolyticus and sterile distilled water amplified with MpJRPdF-MpJRPdR primers; Lane 6 to 10 = Ph. damselae V. alginolyticus, V. harveyi, V. parahaemolyticus and sterile distilled water amplified with MpJRValF-MpJRValR primers; Lanes 11 to 15 = Ph. damselae, V. alginolyticus, V. harveyi, V. parahaemolyticus and sterile distilled water amplified with MpJRVhF-MpJRVhR primers; Lanes 16 to 20 = Ph. damselae, V. alginolyticus, V. harveyi, V. parahaemolyticus and sterile distilled water amplified with MpJRVpF-MpJRVpR primers. Lane M = 1 kb DNA Ladder (Promega)  
a
Figure-2 Optimization of Multiplex PCR amplification a: against bacterial pathogens at various concentration of MgCl2. Lane M = 1 kb DNA Ladder (Promega); Lane 1 = 1.8 mM; Lane 2 = 2.0 mM; Lane 3 = 3.0 mM; Lane 4 = 4.0 mM; Lane 5 = 5.0 mM; Lane 6 = 6.0 mM; b: against bacterial pathogens at various annealing temperatures. Lane M = 1 kb DNA Ladder (Promega); Lane 1 = 56°C; Lane 2 = 58°C; Lane 3 = 60°C; Lane 4 = 62°C; Lane 5 = 64°C 
International Research Journal of Biological Sciences ________________________________________________ ISSN 2278-3202   Vol. 2(12), 79-84, December (2013)  Int. Res. J. Biological Sci.     International Science Congress Association 
82
 
Figure-3 Specificity test against pure bacterial strains and total bacteria from environmental samples. Lane 1 = Ph. damselae SA1; Lane 2 = V. alginolyticus ATCC 17749; Lane 3 = V. harveyi ATCC 35084; Lane 4 = V. parahaemolyticus ATCC 17802; Lane 5 = A. caviae ATCC 15468; Lane 6 = A. hydrophila ATCC 7965; Lane 7 = A. salmonicida subsp. salmonicida ATCC 33658; Lane 8 = Ed. tarda ATCC 15947; Lane 9 = E. coli ATCC 25922; Lane 10 = E. coli JM109; Lane 11 = M. lysodeikticus ATCC 4698; Lane 12 = P. mirabilis ATCC 29245; Lane 13 = Ps. aeruginosa ATCC 27853; Lane 14 = Ps. fluorescens ATCC 13525; Lane 15 = V. anguillarum ATCC 19264; Lane 16 = Y. ruckeri ATCC 29473; Lane 17 = Ph. damselae PDTG2; Lane 18 = V. harveyi VHJR7; Lane 19 = V. harveyi VHJR4; Lane 20 = V. parahaemolyticus VPHG1; Lane 21 = Total bacteria from fish tissue; Lane 22 = Total bacteria from seawater;  Lane 23 = Total bacteria from biofilms; Lane 24 = Total bacteria from freshwater; Lane P = Genomic DNA from all target bacteria; Lane N = Sterile distilled water; Lane M = 1 kb DNA Ladder (Promega) 
Figure-4 Multiplex PCR amplification against different concentration (nanogram) of genomic DNA from target bacterial pathogens. Lane M = 1 kb DNA Ladder (Promega); Lane 1 = 50 ng; Lane 2 = 10 ng; Lane 3 = 1 ng; Lane 4 = 0.1 ng; Lane 5 = 0.01 ng; Lane 6 = 0.001 ng; Lane 7 = Sterile distilled waterBacterial species such as the Ph. damselae, V. alginolyticus, V. harveyi and V. parahaemolyticusare often reported to cause diseases not only to culture fish1-4but also to human5-7.Hence, a rapid and simultaneous detection method for these bacterial pathogens is necessary.The multiplex PCR amplification method described in this study is very helpful for this purpose. Mata et al.12 andFadaeifardet al.16 have also reported that multiplex PCR method was useful for diagnosis of streptococcal 
International Research Journal of Biological Sciences ________________________________________________ ISSN 2278-3202   Vol. 2(12), 79-84, December (2013)  Int. Res. J. Biological Sci.     International Science Congress Association 
83
infections in fish. It is preferable because of its simplicity and cost efficiency compared to the conventional single PCR method22.  The multiplex PCR amplification method we developed in this study has been shown to be highly specific to the target bacteria. It has also successfully amplified the target bacteria seeded in environmental and tissue samples. Although the use of multiple virulent genes (up to 10 genes) was not highly recommended for multiplex PCR14, the result of our study showed otherwise. However, the drawback of multiplex PCR is often related to its sensitivity. In this study, the lowest concentration of DNA which can be successfully amplified was at 10pg. This is in agreement with the findings of Wei et al.23. Generally, the concentration of bacterial pathogens in environment is often low, which causes detection difficulty and can lead to false-negative result. However, it can be overcome by the enrichment of bacterial cells using a general-purpose media such as peptone water24 and tryptic soy broth25. Such situation has also been shown in this study where environmental and tissue samples seeded with the bacterial cells were successfully amplified. Panicker et al.14have also suggested that cell enrichment improve detection capacity of multiplex PCR to food-borne pathogens (V. cholerae, V. parahaemolyticus and V. vulnificus) in shellfish tissues. Conclusion The multiplex PCR amplification method described in this study was shown to be specific and simultaneously amplified the target bacterial pathogens. The rapidity, simplicity and cost effectivenessof the multiplex PCR amplification method may provide useful biosecurity tool for determination of the pathogens in aquaculture farmsand seafood processing industries throughout tropical countries. AcknowledgementsThis study was jointly funded bythe Ministry of Education Malaysia(Fundamental Research Grant Scheme No. FRGS/1/2013/STWN03/UMS/02/4) and Ministry of Science, Technology and Innovation Malaysia (e-Science Fund No. 04-01-10-SF0172). References 1.Alcaide E., Amaro C., Todolí R. and Oltra R., Isolation and characterization of Vibrio parahaemolyticus causing infection in Iberian toothcarpAphaniusiberus, Dis Aquat Organ., 35, 77–80 (1999) 2.Labella A., Vida M., Alonso M.C., Infente C., Cardenas S., Lopez-Romalde S., Manchado M. and Borrego J.J.,(2006) First isolation of Photobacteriumdamselaessp. Damselae from cultured redbandedseabream, Pagrusauriga Valenciennes, in Spain, J Fish Dis, 29, 175–179 (2006) 3.Ransangan J. and Mustafa S., Identification of Vibrio harveyi isolated from diseased asianseabass Latescalcariferby use of 16S ribosomal DNA sequencing, J AquatAnim Health, 21,150–155 (2009) 4.Yanuhar U., The role of immunogenic adhesion Vibrio alginolyticus 49 kDa to molecule expression of major histocompatibility complex on receptor of humpback grouper Cromileptesaltivelis, World Academy SciEng Technol., 43, 968–973 (2010) 5.Asato J. andKanaya F., Fatal infection of the hand due to Photobacteriumdamselae: a case report, Clin Infect Dis., 38, 100–101 (2004) 6.Schmidt U., Chamel H. andCobbs C.,Vibrio alginolyticus infections in humans, J ClinMicrobiol., 10(5), 666–668 (1979) 7.Shirai H., Ito H., Hirayama T., Nakabayashi Y., Kumagai K., Takeda Y. andNishibuchi M., Molecular epidemiologic evidence for association of thermostable direct hemolysin (TDH) and TDH-related hemolysin of Vibrio parahaemolyticus with gastroenteritis, Infect Immun., 58, 3568–3573 (1990) 8.Fabbro C., Celussi M., Russell H. and Del Negro P., Phenotypic and genetic diversity of coexisting Listonellaanguillarum, Vibrio harveyi and Vibrio chagassirecovered from skin haemorrhages of diseased sand smelt, Atherinaboyeri, in the Gulf of Trieste (NE Adriatic Sea), LettApplMicrobiol.,54, 153–159 (2012) 9.Oliver J.D. andKaper J.B., Vibrio species. In Food Microbiology: Fundamentals and Frontier ed Doyle MP, Beuchat LR, Montville TJ, ASM Press, Washington, pp. 263 – 300(2001) 10.Thompson F.L., Gevers D., Thompson C.C.,Dawyndt P., Naser S., Hoste B., Munn C.B. and Swings J., Phylogeny and molecular identification of Vibrios on the basis of multilocus sequence analysis, Appl Environ Microbiol., 71, 5107–5115 (2005) 11.Lal M.T.B.M. and Ransangan J., Taxonomic classification of Vibrio harveyi using 16S rDNA and atpAgene sequencing method, Int J Res Pure ApplMicrobiol., , 17–24 (2013) 12.Mata A.I., Gibello A., Casamayor A.,Blanco M., Domínguez L. andFernández-Garayzábal, Multiplex PCR assay for detection of bacterial pathogens associated with warm-water streptococcosis in fish, Appl Environ Microbiol.,70, 3183–3187 (2004) 13.Chen Y. andKnabel S.J., Multiplex PCR for silmutaneous detection of bacteria of the genus Listeria, Listeriamonocytogenes, and major serotypes and epidemic clones of L.monocytogenesAppl Environ Microbiol.,73, 6299–6304 (2007) 
International Research Journal of Biological Sciences ________________________________________________ ISSN 2278-3202   Vol. 2(12), 79-84, December (2013)  Int. Res. J. Biological Sci.     International Science Congress Association 
84
14.Panicker G., Call D.R., Krug M.J. andBej A.K., Detection of pathogenic Vibrio spp. in shellfish by using multiplex PCR and DNA microarrays, Appl Environ Microbiol., 70, 7436–7444 (2004) 15.Bauer A. andRørvik L.M., A novel multiplex PCR for the identification of Vibrio parahaemolyticus, Vibrio choleraeand Vibrio vulnificusLettApplMicrobiol.,45, 371–375 (2007) 16.Fadaeifard F., Momtaz H., Rahimi E. andMirzakhani A., Detection of Streptococcus iniae and Lactococcusgarvieaeby multiplex polymerase chain reaction (PCR) in some rainbow trout farms of Iran,African J Biot.,11, 260–263 (2012) 17.Osorio C.R. andKlose K.E., A region of the transmembrane regulatory protein ToxR that tethers the transcriptional activation domain to the cytoplasmic membrane displays wide divergence among Vibrio species, J Bacteriol., 182, 526–528 (2000) 18.Phillips A.J. and Simon C., Simple, efficient, and nondestructive DNA extraction protocol for arthropods,Ann EntomolSoc Am.,88, 281–283(1995) 19.Takeuchi H., Shibano Y., Morihara K., Fukushima J., Inami S., Keil B., Gilles A-M., Kawamoto S. and Okuda K., Structural gene and complete amino acid sequence of Vibrio alginolyticuscollagenase,Biochem J., 281, 703–708 (1992) 20.Ransangan J., Lal M.T. and Al-Harbi A.H., Characterization and experimental infection of Vibrio harveyi isolated from diseased Asian seabass Latescalcarifer),Malays J Microbiol.,, 104–115 (2012) 21.Matsumoto C., Okuda J., Ishibashi M., Iwanaga M., Garg P., Rammamurthy T., Wong H–C., Depaola A., Kim Y.B., Albert, M.J. andNishibuchi M., Pandemic spread of an O3:K6 clone of Vibrio parahaemolyticus and emergence of related strains evidenced by arbitrarily primed PCR and toxRS sequence analyses,J ClinMicrobiol.,38, 578–585 (2000) 22.Edward M.C. and Gibbs R.A., Multiplex PCR: advantages, development, and applications,Genome Res.,, 65–75 (1994) 23.Wei B., Cha S–Y., Kang M., Park I–J., Moon O–K., Park C-K. and Jang H–K., Development and application of a multiplex PCR assay for rapid detection of 4 major bacterial pathogens in ducks, Poultry Sci.,92, 1164–1170 (2013) 24.Thomason B.M., Dood D.J. and Cherry W.B., Increased recovery of Salmonellae from environmental samples enriched with buffered peptone water,Appl Environ Microbiol.,34, 270–273 (1977) 25.Murk J-L., Heddema E.R., Hess D.L.,Bogaards J.A.,Vandenbroucke-Grauls C.M.J.E. andDebets-Ossenkopp Y.J., Enrichment broth improved detection of extended-spectrum-beta lactamase-producing bacteria in throat and rectal surveillance cultures of samples from patients in intensive care units,J ClinMicrobiol., 47, 1885–1887 (2009) 
<end>